bynanoe biroe. 31,129 views, added to favorites 10 times. Difficulty: beginner. Tuning: E A D G B E. Author bhaskaraputra88 [a] 32. Last edit on Jun 30, 2020. suba maju, presiden R.I. mapilih G langsung F C F Reformasi, suba majalan, rakyat cenik milu G maitung Am Em F Yening adi mula tresna, mai jak beli kawin C G lari Am Em F Malaib atas
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCCCCCEmCCCCCCFCCCCCCGCCCCCCCCCCCCCCCCCEmCCCCCCFCCCCCCCGCCCCCCCAmCCCCCCCEmCCCCCCCFCCGCCCCCCCCCCGCAmCCCCCDCEmCCCCCCCFCCCCCCGCCCCCCCCCCCCCCEmCCCCCBmCCCAmCCCEmCCCFCCCCCCCCCCCECCCCCCCGCCCAmCCCEmCCCFCCCCCCCCCFmCCCDCACCCCCCCCmCCCCCCDCCCCCCCCECCCCCCCCCCCCCCCECCCCCCCFCCCCCCCGCCCCCCCCCCCCCCCECCCCCCCFCCCCCCCGCCCCCCCCCCCCCCCECCCCCCCFCCCCCCCGCCCCCCCAmCCCCCCCEmCCCCCCCFCCCGCCCCCCCCGCCACCCCCCCEmCCCCCCCFCCCCCCCCCCCCCCCCCCCCCCCAmCCCEmCCCFCCCCCCCCCFmCCCCCCCCCCCCCAmCCCEmCCCFCCCCCCGmCCCCCCCEmGCCCCCCCCCCCCCCAmCCCCCEmCCCFCCCCCCCCCCCCCCCCCCGCCCAmCCCEmCCCFCCCCCCCCCCCCCCCCCCCCEmCCACCCCEmCCFCCCCCCCGCCCCCCCCCCCEmCCCACCCCEmCCFCCCCCCCCCCCCCCCFmCCCCCCCCCCCCCEmCCCCCACFCCACCFCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
KumpulanKunci Gitar Nanoe Biroe Terbaru dan Terupdate dengan Kunci Gitar dasar yang Mudah dimainkan untuk Pemula yang ingin belajar alat musik. Website yang berisi kumpulan chord (akord) / kunci gitar mudah dan dasar beserta lirik lagu indonesia maupun mancanegara.
๏ปฟalbum Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCCCCCCCCCCCCCCCCCCCCEmCCCCCCCFCCCCCCCGCCCCCCCCCCCCCCCCEmCCCCCCFCCCCCCGCCCCCCCCAmCCCCCCCEmCCCCCCCFCCGCCCCCCCCCCCCACCCCCCCEmCCCCCCCFCCCCCCGCCCCCCCCCCCCCCEmCCCCCBmCCCAmCCCEmCCCFCCCCCCCCCCCECCCCCCCBmCCCAmCCCEmCCCFCCCCCCCCCFmCCCDCACCCCCCCCmCCCCCCDCCCCCCCCECCCCCCCCCCCCCCCECCCCCCCFCCCCCCCGCCCCCCCCCCCCCCCECCCCCCCFCCCCCCCGCCCCCCCCCCCCCCCECCCCCCCFCCCCCCCGCCCCCCCAmCCCCCCCEmCCCCCCCFCCCGCCCCCCCCGCCACCCCCCCEmCCCCCCCFCCCCCCCCCCCCCCCCCCCCCCAmCCCCEmCCCFCCCCCCCCCFmCCCCCCCCCCCCCAmCCDCEmCCFCCCCCCCCGCCCCCCCCCCCCCCCCCCGCCCAmCCCEmCCCFCCCCCCCCCCCACCCCCCCGCCCAmCCCEmCCCFCCCCCCCCCCCCCCCCCCCEmCCCACCCEmCCCFCCCCCCCGCCCCCCCCCCCEmCCCACCCEmCCCFCCCCCCCCCCCCCCCFmCCCCCCCCCCCCCEmCCCCCCCFCCACCFCCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
. x2c5h1h5f7.pages.dev/637x2c5h1h5f7.pages.dev/542x2c5h1h5f7.pages.dev/480x2c5h1h5f7.pages.dev/109x2c5h1h5f7.pages.dev/497x2c5h1h5f7.pages.dev/224x2c5h1h5f7.pages.dev/412x2c5h1h5f7.pages.dev/396x2c5h1h5f7.pages.dev/425x2c5h1h5f7.pages.dev/299x2c5h1h5f7.pages.dev/480x2c5h1h5f7.pages.dev/819x2c5h1h5f7.pages.dev/836x2c5h1h5f7.pages.dev/167x2c5h1h5f7.pages.dev/855
kunci gitar nanoe biroe iluh suba mati
